What are the primer sequences for sequencing pDONR201 C.elegans ORF clones?

The primer sequences for sequencing pDONR201 are: SeqL-A (proximal to attL1) TCGCGTTAACGCTAGCATGGATCTC (106 nt from cloned ORFs) SeqL-B (proximal to attL2) GTAACATCAGAGATTTTGAGACAC (123 nt from cloned ORFs)