Is the EG5 control in pGIPZ specific for only human?

Yes, the EG5 control we have in pGIPZ is specific for human ONLY. It will not work in mouse. aligns to: NM_004523.2 Homo sapiens kinesin family member 11 (KIF11), mRNA Length=4908 Query 1 GGCCATGCTAGAAGTACATAA 21 Sbjct 1811 GGCCATGCTAGAAGTACATAA 1831