• Edit-R HDR Donor Designer - plasmid

    This tool is for designing and ordering the DNA components required to build a custom donor plasmid for insertion of EGFP, mKate2, or a custom sequence to any genomic site.

    To design a guide RNA to cut near the genomic alteration site of interest, first use the CRISPR Design Tool.

    If you already have a guide RNA that is near the desired insertion site, enter the gene information and 20 nt guide RNA target sequence below.

    Need some additional guidance? Visit the HDR Donor Designer Workflow page to learn more.

  • Help Tooltip
    Guide RNA will be designed using selected nuclease.  
    Help Tooltip
    Protospacer adjacent motif.  For custom nuclease input 2 to 7 nt with at least 1 standard base (A,C, G or T).
    NGG
    Help Tooltip
    PAM position relative to DNA target sequence.
    After target
    Help Tooltip
    Length of guide RNA target sequence.
    20
    Help Tooltip
    Position of double-strand break on sense and antisense strands as measured from the 5' end of the sense strand.  For image see CRISPR User guide.
    Sense
    17
    Anti-sense
    17
    Help Tooltip
    Repeat sequence of the guide RNA (added to the target sequence in synthesis).
    GTTTTAGAGCTATGCTGTTTTG
    Help Tooltip
    Position of repeat sequence relative to the target sequence of guide RNA.
    Repeat is 3'