Home | Resources | FAQs

What sequencing primers can I use for the OCC ORF clones?

From the OCC website http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1: "Sequencing primers (M13F and T7 Rev) that prime from outside of the attL sites are generally suitable for sequencing inserts larger than ~500 nt, but they may provide incomplete sequences for smaller inserts, due to L1-L2 hairpin formation. The use of sequencing primers GW1 and GW2 should be suitable for sequencing of all sizes of inserts." GW1 5' GTTGCAACAAATTGATGAGCAATGC GW2 5' GTTGCAACAAATTGATGAGCAATTA

Related Categories: