Home | Resources | FAQs

What is the sequence of the TRC eGFP hairpin?

The sequence of the TRC Lentiviral eGFP shRNA positive control (RHS4459) is as follows: TACAACAGCCACAACGTCTAT

Related Categories: