Home | Resources | FAQs

What is the recommended primer for sequencing Human ORF clones in the pDONR223 vector?

Sequencing primer for the insert in pDONR223 (found in product insert): 5' - TTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGT - 3' Also, there is a 20bp match between the T7 promoter and the "reverse primers" region of pDONR223. The so-called "T7 short" primer (http://cancer-seqbase. uchicago.edu/primers.html) sequence (TAATACGACTCACTATAGGG) matches perfectly. There are no T7 or SP6 promoters.

Related Categories: