Home | Resources | FAQs

What are the primer sequences for the Yeast Tiling Path pGP564 vector?

The oligos that were used for sequencing are as follows: 5' TAAGTTGGGTAACGCCAGGG 3' 5' AGCGGATAACAATTTCACACAGGA 3' (this is the m13 -48 reverse sequencing 24-mer oligo) The inserts were ligated into the BamHI site, which is 138 nt from the end of the forward primer, and 99 nt from the end of the reverse primer. For us the standard m13 forward primer did not work well, probably due to a related or duplicated sequence somewhere.

Related Categories: