Home | Resources | FAQs

What is the non-silencing control hairpin sequence?

The non-silencing control hairpin sequence is as follows: TGCTGTTGACAGTGAGCGATCTCGCTTGGGCGAGAGTAAGTAGTGAAGCCACAGATGTACTTACTCTCGCCCAAGCGAGAGTGCCTACTGCCTCGGA 22mer sense: ATCTCGCTTGGGCGAGAGTAAG 22mer antisense: CTTACTCTCGCCCAAGCGAGAG This sequence does not match any known mammalian genes (had at least 3 or more mismatches against any gene as determined via nucleotide alignment/BLAST of 22mer sense sequence). This is the non-silencing shRNAmir hairpin sequence found in the pSM2, pSMP, pGIPZ, pTRIPZ and pLemiR non-silencing controls.

Related Categories: