Home | Resources | FAQs

What is the 3X HA-tag sequence?

GCGGCCGTTTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCGGACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTCCGGCCGCC Source: Kumar, A., des Etages, S.A., Coelho, P.S.R., Roeder, G.S., and Snyder, M. Methods Enzymol 328, 550 (2000).

Related Categories: