Is there a recommended sequencing primer for the Yeast YFP Fusion Collection

Per the source lab, the following primer should be used: R-seq_primer: GTGTTGGCCATGGAACAGGTAG This will sequence from the fluorescent protein (towards its start codon) running in the direction of the 3'-end of the target gene.