Is it possible to use the BLAST tool on the website with multiple FASTA files?

Yes, it is possible. Paste the FASTA of multiple sequences into the search for the BLAST. They need to be separated by headers like below: >SEQ1 ACGTTTCATATTTATAGCTACTTATTCACCT >SEQ2 GCCCTACATAAAACCCAGGAGTCA The results for each sequence can be seen by using the ‘next sequence’ or ‘previous sequence’ selection at the top of the BLAST result. The center label on the BLAST results page shows heading for the results that you are viewing (ex. "SEQ1"). The ‘Next Query’ hyperlink will allow you to see the results for the next header (ex. "SEQ2"), etc.

Share: